Drop links or images here to add them to the editor.

Sanger sequencing is a method used to determine the DNA sequence of an organism. Developed by Frederick Sanger and colleagues in 1977, it was the most widely used sequencing method for approximately 25 years. The method is applied by radioactively or fluorescently labelling the four DNA-bases (represented by the letters A, C, G and T), so that successive bases can be read out sequentially. The radioactive or fluorescent labels can be read automatically using 4 different detectors that determine for each position in the DNA whether a radioactive or fluorescent signal is present for each of the four bases. This results in four separate signals that are then merged into a single signal, from which the DNA sequence itself may be determined.

sanger sequenering

If the detector for base X (with X being one of the letters A, C, G or T) registers a positive signal at a certain position, the position is marked by the letter X. If no signal is detected, the position is marked by a hyphen. As such, the output of all four detectors — as measured for the DNA sequence ATGCTTCGGCAAGACTCAAAAAATA — is represented in the following format:

                          1111111111222222
                 1234567890123456789012345
detector A:      A---------AA-A---AAAAAA-A
detector C:      ---C--C--C----C-C--------
detector G:      --G----GG---G------------
detector T:      -T--TT---------T-------T-
                 =========================
DNA sequence:    ATGCTTCGGCAAGACTCAAAAAATA

Assignment

Write a function sanger that takes a string argument that only contains the upper case letters A, C, G and T. This argument represents a DNA sequence. The function must return a string that represents the given DNA-sequence using the following format:

Make sure that the last line returned by the function sanger, does not end with a newline. Take a look at the interactive Pyton session below to see some examples on how the formatting of the DNA-sequences must be done. 

Example

>>> print(sanger('ATGCTTCGG'))
123456789
A--------
---C--C--
--G----GG
-T--TT---
=========
ATGCTTCGG
>>> print(sanger('ATGCTTCGGCAAGACTCAAAAAATA'))
         1111111111222222
1234567890123456789012345
A---------AA-A---AAAAAA-A
---C--C--C----C-C--------
--G----GG---G------------
-T--TT---------T-------T-
=========================
ATGCTTCGGCAAGACTCAAAAAATA