Drop links or images here to add them to the editor.

The GenBank sequence database is an open access, annotated collection of all publicly available nucleotide sequences and their protein translations. This database receives sequences produced in laboratories throughout the world from more than 100.000 distinct organisms. In the more than 30 years since its establishment, GenBank has become the most important and most influential database for research in almost all biological fields, whose data are accessed and cited by millions of researchers around the world. GenBank continues to grow at an exponential rate, doubling every 18 months. In February 2013, the database contained over 150 billion nucleotide bases in more than 162 million sequences.

GenBank records sometimes contain long genome sequences or sequence fragments. Look at this example GenBank record containing a gene of Saccharomyces cerevisiae (baker's yeast). At the bottom of the record, you can see a clear overview of the sequence, using a format that prints the sequence across multiple lines. This is done by breaking the sequence into blocks of size $$m$$, and putting $$n$$ successive blocks separated by spaces on a single line. The letters of the sequence are always converted into lower case in the GenBank format. Depending on the length of the sequence, the last line does not necessarily contain $$n$$ blocks, and the last block on that line does not necessarily has size $$m$$. Each line starts with an integer that indicates the position of the first letter on the line in the original sequence. Positions in the sequence are indexed from 1. The integer that indicates the position is right-aligned over $$k$$ positions and followed by a space. The integer $$k$$ is the number of digits of the integer that is at the start of the last line in the GenBank formatted sequence.

Assignment

Write a function genbank that takes three arguments: i) the size of a block $$m$$, ii) the maximal number of blocks per line $$n$$ and iii) a string $$s$$ that only contains letters of the alphabet (both upper case and lower case letters are allowed). The function must return a string that contains a version of the string $$s$$ in GenBank format. To do so, the string $$s$$ must be broken into blocks of size $$m$$, and each line must contain up to $$n$$ blocks, preceded by the position of the first letter of the first block within the string $$s$$. Make sure that the last line of the string returned by the function does not end with a newline character.

Example

>>> print(genbank(4, 3, 'AGGCTGTCAATGCTAGGCATAgaagtcgTGCTGTAGagatagTCTGATAGTCGC'))
 1 aggc tgtc aatg
13 ctag gcat agaa
25 gtcg tgct gtag
37 agat agtc tgat
49 agtc gc
>>> print(genbank(5, 2, 'GGATGCTGGTAGATCGATAT'))
 1 ggatg ctggt
11 agatc gatat
>>> print(genbank(10, 6, 'AGCT' * 252))
  1 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
 61 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
121 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
181 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
241 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
301 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
361 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
421 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
481 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
541 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
601 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
661 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
721 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
781 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
841 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
901 agctagctag ctagctagct agctagctag ctagctagct agctagctag ctagctagct
961 agctagctag ctagctagct agctagctag ctagctagct agctagct