Drop links or images here to add them to the editor.

In genetics, a distinction is made between two types of mutations (the replacement of one nucleotide by a different nucleotide). A transition changes a purine nucleotide (two rings) into another purine (AG), or changes a pyrimidine nucleotide (one ring) into another pyrimidine (CT). All other mutations in which a purine is substituted for a pyrimidine, or vice versa, are called transversions.

mutations

Although in theory there are only four possible transitions and eight possible transversions, in practice transitions are more likely than transversions because substituting a single ring structure for another single ring structure is more likely than substituting a double ring for a single ring. Also, transitions are less likely to result in amino acid substitutions (due to wobble base pair) and are therefore more likely to persist as silent substitutions in populations.

Assignment

In this assignment we represent DNA sequences as strings that only contains the letters A, C, G and T. These letters represent the nucleotides that make up the DNA sequence. The nucleotides can also be represented using their lowercase variants. Given two DNA sequences $$s_1$$ and $$s_2$$ that have the same length, we define their transition/transversion ratio $$R(s_1, s_2)$$ as the ratio of the number of transitions to the number of transversions, where nucleotides at the corresponding positions between the two DNA sequences are compared with each other.

The transition/transversion ratio between homologous strands of DNA is generally about 2, but it is typically elevated in coding regions, where transversions are more likely to change the underlying amino acid and thus possibly lead to a fatal mutation in the translated protein. Point mutations that do not change this amino acid (which are thus more likely for transitions) are called silent substitutions. Your task:

None of these function may make a distinction between uppercase and lowercase letters in the arguments passed to them.

Example

>>> transition('G', 'A')
True
>>> transition('t', 'g')
False
>>> transition('C', 'c')
False

>>> transversion('G', 'A')
False
>>> transversion('t', 'g')
True
>>> transversion('C', 'c')
False

>>> ratio('ATTAGCATTATCATC', 'AAATAGGATATATGG')
0.2222222222222222

>>> seq1 = 'GCAACGCACAACGAAAACCCTTAGGGACTGGATTATTTCGTGATCGTTGTAGTTATTGGAAGTACGGGCATCAACCCAGTT'
>>> seq2 = 'ttatctgacaaagaaagccgtcaacggctggataatttcgcgatcgtgctggttactggcggtacgagtgttcctttgggt'
>>> ratio(seq1, seq2)
1.2142857142857142