Drop hier links of afbeeldingen om ze aan de editor toe te voegen.

In molecular biology and genetics, GC-content (or guanine-cytosine content) is the percentage of nitrogenous bases on a DNA or RNA molecule that are either guanine or cytosine (from a possibility of four different ones, also including adenine and thymine in DNA and adenine and uracil in RNA).

GC content is usually expressed as a percentage value, and is calculated as

\[\frac{G + C}{A + T + G +C}\]

The CG-content of a sequence has important biological concequences. For this exercise we will distinguish the following classes of sequences.

Assignment

Write a program to determine the GC-content and class of a DNA sequence.

Input

A single line with a DNA sequence as a string.

Output

A single line containing the sentence This sequence has a ###### GC-content of ##.##%. .

Example

Input:

TACCCACGAGGCCAACAGCTGGGAGAGGATCAGCTTCAGGACCTACACCTAGAAGGATTA

Output:

This sequence has a low GC-content of 34.00%.